Znf217 Inhibitors And Assaya

Lab Reagents

Human IgG antibody Laboratories manufactures the znf217 inhibitors and assaya reagents distributed by Genprice. The Znf217 Inhibitors And Assaya reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact inhibitor assay. Other Znf217 products are available in stock. Specificity: Znf217 Category: Inhibitors Group: And Assaya

And Assaya information

ZNF217 cloning plasmid
CSB-CL026586HU-10ug 10ug
EUR 1126
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3147
  • Sequence: ATGCAATCGAAAGTGACAGGAAACATGCCAACTCAATCCCTCTTAATGTACATGGATGGGCCAGAAGTGATTGGCAGCTCTCTTGGCAGTCCGATGGAGATGGAGGATGCCTTGTCAATGAAAGGGACCGCTGTTGTTCCATTCCGAGCTACACAAGAAAAAAATGTCATCCAAA
  • Show more
Description: A cloning plasmid for the ZNF217 gene.

ZNF217 Rabbit pAb
A7002-100ul 100 ul
EUR 308

ZNF217 Rabbit pAb
A7002-200ul 200 ul
EUR 459

ZNF217 Rabbit pAb
A7002-20ul 20 ul
EUR 183

ZNF217 Rabbit pAb
A7002-50ul 50 ul
EUR 223

pDONR223-ZNF217 Plasmid
PVTB00969-1 2 ug
EUR 356

Anti-ZNF217 antibody
STJ113391 100 µl
EUR 277

Anti-ZNF217 antibody
STJ29082 100 µl
EUR 277

Anti-ZNF217 antibody
STJ70953 100 µg
EUR 359

Chk1 and MK2 Inhibitors set
A9908-1 1 set
EUR 456
Description: PF477736 and PF3644022 are potent and selective Chk1- and MK2 inhibitors, respectively.The simultaneous Chk1- and MK2 inhibition with PF477736 and PF3644022 is proposed as a therapeutic strategy for the treatment of KRAS-or BRAF-driven cancers.

Polyclonal ZNF217 Antibody (Internal)
APG01169G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ZNF217 (Internal). This antibody is tested and proven to work in the following applications:

Human ZNF217 shRNA Plasmid
20-abx955256
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal ZNF217 Antibody (N-term)
APR04087G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZNF217 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ZNF217 Antibody (internal region)
APG00468G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ZNF217 (internal region). This antibody is tested and proven to work in the following applications:

ZNF217 ORF Vector (Human) (pORF)
ORF015021 1.0 ug DNA
EUR 95

Zinc Finger Protein 217 (ZNF217) Antibody
20-abx005305
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Finger Protein 217 (ZNF217) Antibody
20-abx127087
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.